Quellcodebibliothek Statistik Leitseite products/Sources/formale Sprachen/C/Firefox/build/pgo/js-input/sunspider/   (Browser von der Mozilla Stiftung Version 136.0.1©)  Datei vom 10.2.2025 mit Größe 3 kB image not shown  

Quelle  string-fasta.html   Sprache: HTML

 
 products/Sources/formale Sprachen/C/Firefox/build/pgo/js-input/sunspider/string-fasta.html


<!DOCTYPE html>
<head>
<!--
 Copyright (C) 2007 Apple Inc.  All rights reserved.

 Redistribution and use in source and binary forms, with or without
 modification, are permitted provided that the following conditions
 are met:
 1. Redistributions of source code must retain the above copyright
    notice, this list of conditions and the following disclaimer.
 2. Redistributions in binary form must reproduce the above copyright
    notice, this list of conditions and the following disclaimer in the
    documentation and/or other materials provided with the distribution.

 THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY
 EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
 IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
 PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL APPLE COMPUTER, INC. OR
 CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
 EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
 PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
 PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
 OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
 (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
 OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. 
-->


<title>SunSpider string-fasta</title>

</head>

<body>
<h3>string-fasta</h3>
<div id="console">
</div>

<script>

var _sunSpiderStartDate = new Date();

// The Great Computer Language Shootout
//  http://shootout.alioth.debian.org
//
//  Contributed by Ian Osgood

var last = 42, A = 3877, C = 29573, M = 139968;

function rand(max) {
  last = (last * A + C) % M;
  return max * last / M;
}

var ALU =
  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";

var IUB = {
  a:0.27, c:0.12, g:0.12, t:0.27,
  B:0.02, D:0.02, H:0.02, K:0.02,
  M:0.02, N:0.02, R:0.02, S:0.02,
  V:0.02, W:0.02, Y:0.02
}

var HomoSap = {
  a: 0.3029549426680,
  c: 0.1979883004921,
  g: 0.1975473066391,
  t: 0.3015094502008
}

function makeCumulative(table) {
  var last = null;
  for (var c in table) {
    if (last) table[c] += table[last];
    last = c;
  }
}

function fastaRepeat(n, seq) {
  var seqi = 0, lenOut = 60;
  while (n>0) {
    if (n<lenOut) lenOut = n;
    if (seqi + lenOut < seq.length) {
      ret = seq.substring(seqi, seqi+lenOut);
      seqi += lenOut;
    } else {
      var s = seq.substring(seqi);
      seqi = lenOut - s.length;
      ret = s + seq.substring(0, seqi);
    }
    n -= lenOut;
  }
}

function fastaRandom(n, table) {
  var line = new Array(60);
  makeCumulative(table);
  while (n>0) {
    if (n<line.length) line = new Array(n);
    for (var i=0; i<line.length; i++) {
      var r = rand(1);
      for (var c in table) {
        if (r < table[c]) {
          line[i] = c;
          break;
        }
      }
    }
    ret = line.join('');
    n -= line.length;
  }
}

var ret;

var count = 7;
ret = fastaRepeat(2*count*100000, ALU);
ret = fastaRandom(3*count*1000, IUB);
ret = fastaRandom(5*count*1000, HomoSap);



var _sunSpiderInterval = new Date() - _sunSpiderStartDate;

document.getElementById("console").innerHTML = _sunSpiderInterval;
</script>


</body>
</html>

Messung V0.5
C=75 H=98 G=87

¤ Dauer der Verarbeitung: 0.20 Sekunden  (vorverarbeitet)  ¤

*© Formatika GbR, Deutschland






Wurzel

Suchen

Beweissystem der NASA

Beweissystem Isabelle

NIST Cobol Testsuite

Cephes Mathematical Library

Wiener Entwicklungsmethode

Haftungshinweis

Die Informationen auf dieser Webseite wurden nach bestem Wissen sorgfältig zusammengestellt. Es wird jedoch weder Vollständigkeit, noch Richtigkeit, noch Qualität der bereit gestellten Informationen zugesichert.

Bemerkung:

Die farbliche Syntaxdarstellung und die Messung sind noch experimentell.